. Percp, Miltenyi Biotec), mouse anti-CD11c APC(17-0114, eBioscience), mouse anti-CD45 vioblue (130-102-430, Miltenyi Biotec), mouse nti-CD3 Violetfluor 450 (75-0032, Tonbo biosciences), mouse anti-Prominin1 APC (130-092-335, Miltenyi Biotec) Results are expressed as ratio of immune cells/tubular cells, an internal control allowing to quantify immune cells infiltrate in the whole kidney, pp.130-102

R. Quantitative, Qiagen) according to manufacturer's instructions. RNA concentration was measured by using NanoDrop1000 spectrophotometer (ThermoScientific) RNA were reverse transcribed using Maxima First Strand cDNA Synthesis Kit (Thermoscientific) and PCR was performed using SYBR green and specific primers on a light cycler 480 (Roche) Expression levels were normalized to the house keeping gene GusB (beta-glucuronidase) or 18 S using lightcycler advanced relative quantification program (Roche) Primers used were from eurogentec: Rabbit Cast s: AGCCAGCAAGTCGCTCAG and as: CCATCTCTTTGCTGATTGGAA, mouse Cast s: TCGCAAGTT GGTGGTACAAG and as: CTCCCCAAACTTGCTGCTT, mouse Calpn1 s: AGTGGAAAGGACCCTGGAGT and as: TCTCGTTCATAGGGGTCCAC, mouse Calpn2 s: TGGCTTCGGCATCTATGAG and as: AAGTTTTTGCC GAGGTGGAT, mouse IL1 alpha s: TTGGTTAAATGACCTGCAACA and as: GAGCGCTCACGAACAGTTG, mouse IL1 beta s: TGTAATGAAAGACGGCACACC and as: TCTTCTTTGGGTATTGCTTGG, mouse p21 var1, mRNA from kidney cortex was extracted using the RNeasy kit s: TGCGCTTGGAGTGATAGAAA and as: AACATCTCAGGGCCGAAA, mouse Gusb s: CTCTGGTGGCCTTAC CTGAT and as: CAGTTGTTGTCACCTTCACCTC, mouse 18 S s: AAGCATTCTGAAATTGGCTCA and as

D. E. Goll, V. F. Thompson, H. Li, W. Wei, and J. Cong, The Calpain System, Physiological Reviews, vol.83, issue.3, pp.731-801, 2003.
DOI : 10.1152/physrev.00029.2002

J. Peltier, Calpain Activation and Secretion Promote Glomerular Injury in Experimental Glomerulonephritis: Evidence from Calpastatin-Transgenic Mice, Journal of the American Society of Nephrology, vol.17, issue.12, pp.3415-3423, 2006.
DOI : 10.1681/ASN.2006050542

L. Zafrani, Calpastatin Controls Polymicrobial Sepsis by Limiting Procoagulant Microparticle Release, American Journal of Respiratory and Critical Care Medicine, vol.185, issue.7, pp.744-755, 2012.
DOI : 10.1164/rccm.201109-1686OC

URL : http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3326423

F. Wan, Calpastatin overexpression impairs postinfarct scar healing in mice by compromising reparative immune cell recruitment and activation, American Journal of Physiology - Heart and Circulatory Physiology, vol.309, issue.11, pp.1883-1893, 2015.
DOI : 10.1152/ajpheart.00594.2015

B. Letavernier, Calpains Contribute to Vascular Repair in Rapidly Progressive Form of Glomerulonephritis: Potential Role of Their Externalization, Arteriosclerosis, Thrombosis, and Vascular Biology, vol.32, issue.2, pp.335-342, 2012.
DOI : 10.1161/ATVBAHA.111.240242

URL : https://hal.archives-ouvertes.fr/hal-00683076

Y. C. Lin, K. Brown, and U. Siebenlist, Activation of NF-kappa B requires proteolysis of the inhibitor I kappa B-alpha: signal-induced phosphorylation of I kappa B-alpha alone does not release active NF-kappa B., Proc. Natl. Acad. Sci. USA 92, pp.552-556, 1995.
DOI : 10.1073/pnas.92.2.552

Y. Kobayashi, Identification of calcium-activated neutral protease as a processing enzyme of human interleukin 1 alpha., Proc. Natl. Acad. Sci. USA, pp.5548-5552, 1990.
DOI : 10.1073/pnas.87.14.5548

P. A. Nuzzi, M. A. Senetar, and A. Huttenlocher, Asymmetric Localization of Calpain 2 during Neutrophil Chemotaxis, Molecular Biology of the Cell, vol.18, issue.3, pp.795-805, 2007.
DOI : 10.1091/mbc.E06-09-0876

URL : http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1805107

A. Bellocq, Somatostatin Increases Glucocorticoid Binding and Signaling in Macrophages by Blocking the Calpain-specific Cleavage of Hsp 90, Journal of Biological Chemistry, vol.266, issue.52, pp.36891-36896, 1999.
DOI : 10.1073/pnas.96.4.1439

E. Letavernier, Targeting the Calpain/Calpastatin System as a New Strategy to Prevent Cardiovascular Remodeling in Angiotensin II-Induced Hypertension, Circulation Research, vol.102, issue.6, pp.720-728, 2008.
DOI : 10.1161/CIRCRESAHA.107.160077

E. Letavernier, Critical role of the calpain/calpastatin balance in acute allograft rejection, European Journal of Immunology, vol.9, issue.2, pp.473-484, 2011.
DOI : 10.1111/j.1600-0854.2008.00714.x

T. Kamo, H. Akazawa, and I. Komuro, Pleiotropic Effects of Angiotensin II Receptor Signaling in Cardiovascular Homeostasis and Aging, International Heart Journal, vol.56, issue.3, pp.249-254, 2015.
DOI : 10.1536/ihj.14-429

M. Zatz and A. Starling, Calpains and Disease, New England Journal of Medicine, vol.352, issue.23, pp.2413-2423, 2005.
DOI : 10.1056/NEJMra043361

R. A. Nixon, The calpains in aging and aging-related diseases, Ageing Research Reviews, vol.2, issue.4, pp.407-418, 2003.
DOI : 10.1016/S1568-1637(03)00029-1

C. Franceschi and J. Campisi, Chronic Inflammation (Inflammaging) and Its Potential Contribution to Age-Associated Diseases, The Journals of Gerontology Series A: Biological Sciences and Medical Sciences, vol.69, issue.Suppl 1, pp.4-9, 2014.
DOI : 10.1093/gerona/glu057

URL : https://academic.oup.com/biomedgerontology/article-pdf/69/Suppl_1/S4/1580428/glu057.pdf

A. V. Orjalo, D. Bhaumik, B. K. Gengler, G. K. Scott, and J. Campisi, Cell surface-bound IL-1alpha is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network, Proc. Natl. Acad. Sci. USA, pp.17031-17036, 2009.

H. Manya, Klotho Protein Deficiency Leads to Overactivation of ??-Calpain, Journal of Biological Chemistry, vol.279, issue.38, pp.35503-35508, 2002.
DOI : 10.1085/jgp.109.3.327

F. Trinchese, Inhibition of calpains improves memory and synaptic transmission in a mouse model of Alzheimer disease, Journal of Clinical Investigation, vol.118, issue.8, pp.2796-2807, 2008.
DOI : 10.1172/JCI34254DS1

M. V. Rao, Specific Calpain Inhibition by Calpastatin Prevents Tauopathy and Neurodegeneration and Restores Normal Lifespan in Tau P301L Mice, Journal of Neuroscience, vol.34, issue.28, pp.9222-9234, 2014.
DOI : 10.1523/JNEUROSCI.1132-14.2014

URL : http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4087203

R. Scalia, A Novel Role for Calpain in the Endothelial Dysfunction Induced by Activation of Angiotensin II Type 1 Receptor SignalingNovelty and Significance, Circulation Research, vol.108, issue.9, pp.1102-1111, 2011.
DOI : 10.1161/CIRCRESAHA.110.229393

V. Subramanian, Calpain Inhibition Attenuates Angiotensin II???induced Abdominal Aortic Aneurysms and Atherosclerosis in Low-density Lipoprotein Receptor???deficient Mice, Journal of Cardiovascular Pharmacology, vol.59, issue.1, pp.66-76, 2012.
DOI : 10.1097/FJC.0b013e318235d5ea

URL : http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3248626

D. A. Howatt, Leukocyte Calpain Deficiency Reduces Angiotensin II???Induced Inflammation and Atherosclerosis But Not Abdominal Aortic Aneurysms in MiceSignificance, Arteriosclerosis, Thrombosis, and Vascular Biology, vol.36, issue.5, pp.835-845, 2016.
DOI : 10.1161/ATVBAHA.116.307285

A. Benigni, D. Corna, and C. Zoja, Disruption of the Ang II type 1 receptor promotes longevity in mice, Journal of Clinical Investigation, vol.119, issue.3, pp.524-530, 2009.
DOI : 10.1172/JCI36703

L. Ferder, F. Inserra, L. Romano, L. Ercole, and V. Pszenny, Decreased glomerulosclerosis in aging by angiotensin-converting enzyme inhibitors, J. Am. Soc. Nephrol, vol.5, pp.1147-1152, 1994.

N. Basso, Protective effect of long-term angiotensin II inhibition, AJP: Heart and Circulatory Physiology, vol.293, issue.3, pp.1351-1358, 2007.
DOI : 10.1152/ajpheart.00393.2007

O. Gross, C. J. Thomas, G. Guarda, and J. Tschopp, The inflammasome: an integrated view, Immunological Reviews, vol.126, issue.Suppl, pp.136-151, 2011.
DOI : 10.1016/j.cell.2006.07.033

O. Gross, Inflammasome Activators Induce Interleukin-1?? Secretion via Distinct Pathways with Differential Requirement for the Protease Function of Caspase-1, Immunity, vol.36, issue.3, pp.388-400, 2012.
DOI : 10.1016/j.immuni.2012.01.018

A. Freund, C. K. Patil, and J. Campisi, p38MAPK is a novel DNA damage response-independent regulator of the senescence-associated secretory phenotype, The EMBO Journal, vol.7, issue.8, pp.1536-1548, 2011.
DOI : 10.1111/j.1474-9726.2008.00377.x

G. Zhang, Hypothalamic programming of systemic ageing involving IKK-??, NF-??B and GnRH, Nature, vol.99, issue.7448, pp.211-216, 2013.
DOI : 10.1016/j.mad.2004.07.003

URL : http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3756938

A. S. Adler, Motif module map reveals enforcement of aging by continual NF-??B activity, Genes & Development, vol.21, issue.24, pp.3244-3257, 2007.
DOI : 10.1101/gad.1588507

H. J. Anders, Of Inflammasomes and Alarmins: IL-1? and IL-1? in Kidney Disease, J. Am. Soc. Nephrol, vol.27, pp.2564-2575, 2016.

Q. Raimbourg, The Calpain/Calpastatin System Has Opposing Roles in Growth and Metastatic Dissemination of Melanoma, PLoS ONE, vol.15, issue.4, p.60469, 2013.
DOI : 10.1371/journal.pone.0060469.g006

T. Sato, Functional analysis of JAK3 mutations in transient myeloproliferative disorder and acute megakaryoblastic leukaemia accompanying Down syndrome, British Journal of Haematology, vol.365, issue.5, pp.681-688, 2008.
DOI : 10.1016/S1097-2765(01)00398-7